Isolation and Molecular Identification of Yeast Strains Causing Spoilage in Labneh Cheese
Cumhuriyet Science Journal, cilt.46, sa.2, ss.195-200, 2025 (TRDizin)
- Yayın Türü: Makale / Tam Makale
- Cilt numarası: 46 Sayı: 2
- Basım Tarihi: 2025
- Doi Numarası: 10.17776/csj.1584801
- Dergi Adı: Cumhuriyet Science Journal
- Derginin Tarandığı İndeksler: TR DİZİN (ULAKBİM)
- Sayfa Sayıları: ss.195-200
- Sivas Cumhuriyet Üniversitesi Adresli: Evet
Özet
Labneh is among the dairy products with high nutritional value in the spreadable cheese category. It is consumed together with other dairy products in domestic food consumption. It has been observed that labneh cheese purchased for consumption spoils in the refrigerator after a while. Samples taken from spoiled labneh cheese were purified by single colony cultivation method (streak-plate technique) in PDA and then purified yeast strains were identified. EurX GeneMATRIX Plant & Fungi DNA isolation kit (Poland) was used for DNA isolation in the identification. The amount and purity of the isolated DNA were measured spectrophotometrically in Thermo Scientific Nanodrop 2000 (USA). For species determination, targeted gene regions were amplified by PCR with universal primers ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'). A single-step PCR process was performed to amplify the region of approximately 700 bases. The amplification results obtained by PCR were electrophoresed in 1.5% agarose gel prepared with 1x TAE buffer at 100 volts for 90 minutes and images were taken under UV light using ethidium bromide dye. The results obtained with ITS1 and ITS4 primers were evaluated using the CAP contig assembly algorithm in BioEdit software to create a consensus sequence. Species determination of yeast isolates was determined according to the closest species in NCBI. One of the two yeast species isolated from spoiled labneh cheese was identified as Yarrowia lipolytica with a similarity rate of 99.06% and the other as Rhodotorula mucilaginosa with a similarity rate of 98.42%. Evolutionary analyses were performed in MEGA11 and the evolutionary distance between the two newly isolated species was shown.